Selecciona o teu tema de fundo: Selecciona o teu tema de fundo: Regista-te para guardares a tua escolha Fechar
x Inscreve-te ou regista-te na HDYO
Loja Donativos
Huntington's Disease Youth Organization

O Gene da Doença de Huntington: Ao microscópio

A HDYO tem mais informação sobre DH disponível para jovens, pais e profissionais no nosso site:

www.hdyo.org

A doença de Huntington é causada por uma expansão num gene específico do ADN da pessoa. Este artigo explora o gene em questão e analisa esta “expansão”. Iremos também utilizar árvores genealógicas para mostrar como é que o gene é herdado e transmitido.

Genes, Cromossomas e ADN

DNA, chromosomes and genes

Primeiro, vamos rever alguns tópicos básicos, começando pelo ADN. ADN é o nome do químico de que são feitos os nossos genes. As letras “ADN” significam Ácido Desoxirribonucleico (sonante, não é?). Não surpreende que ninguém use o nome completo – ADN é muito mais simples de dizer e lembrar.

O ADN é o que herdamos dos nossos pais, e eles herdaram-no dos seus próprios pais, e por aí fora. O nosso ADN decide quem somos, como parecemos e como nos desenvolvemos. Características como a nossa cor de cabelo, cor dos olhos, altura, se somos homem ou mulher, e até aspectos da nossa personalidade são decididos pelo nosso ADN.

ADN é o nome do químico, mas os genes são o que chamamos as instruções que estão armazenadas no ADN. Temos muitos genes – para sermos mais precisos, cerca de 23.000 genes nas células dos nossos corpos. Cada gene é um conjunto de instruções – como uma receita. O gene diz à célula como fazer uma substância química chamada proteína. As proteínas são as máquinas que fazem todas as tarefas importantes nas nossas células, desde fazer com que aconteçam reacções químicas até passarem mensagens de uma célula para outra.

Os genes estão ligados uns aos outros como salsichas e são empacotados em coisas chamadas cromossomas. Existem 46 cromossomas no total. 23 são provenientes de um progenitor e 23 provêm do outro. Cada célula no nosso corpo contém uma cópia de todos os 46 cromossomas.

Alterações genéticas: o gene da doença de Huntington

Tendo explicado o básico, vamos olhar para o gene Huntington. Por vezes acontecem alterações (designadas pelos investigadores como “mutações”) dentro dos cromossomas ou genes. Essas alterações podem mudar a forma como o corpo funciona e causar doenças genéticas. Mesmo uma alteração mínima no gene pode provocar uma alteração dramática na proteína. Imagina uma receita culinária que indicou ao cozinheiro que cozesse a torta durante 400 minutos em vez de 40 e percebes a forma como um erro ortográfico minúsculo nos nossos genes pode provocar grandes problemas.

EM 1993, UMA EQUIPA DE INVESTIGADORES DESCOBRIU O GENE responsável pela doença de Huntington no cromossoma 4. Descobriram que uma parte do gene se repetia muitas vezes, como um gaguejo ou como quando primes uma tecla do teclaaaaaaaaaaaaaaaaaaaaado do computador durante demasiado tempo. Esta repetição é o que provoca o desenvolvimento da doença de Huntington e é conhecida como “repetição CAG”.

O que é a “repetição CAG”??

CAG repeats

Se estás a pensar porque é que o gaguejo no gene Huntington é chamado repetição CAG, bem, é como o que se passa com o “ADN”, é uma abreviatura para termos científicos complicados. Basicamente, o ADN é composto por quatro bases, que são conhecidas como adenina (abreviatura A), citosina ©, guanina (G) e timina (T). Estas bases formam o código por detrás de todo o nosso ADN e genes. Cada gene tem um código diferente e, bem, os cientistas são preguiçosos e não querem estar sempre a escrever estas palavras complicadas, por isso usam as versões abreviadas. Assim, as quatro bases do ADN são conhecidas como A, C, G e T e se alguém tiver que escrever um código genético, ficará parecido com qualquer coisa como: AAGTCCTGACTGGGACCTTGAGA CCTAG.

Se um gene é como uma receita, então as bases são como o alfabeto de letras que compõe as instruções da receita. Os genes utilizam um alfabeto muito simples, só com quatro letras à escolha. Mas a ortografia é igualmente importante.

O gene que causa a doença de Huntington contém uma secção onde as bases C, A e G são repetidas muitas vezes – a “repetição CAG”. A maioria das cópias do gene contêm entre 10 a 20 repetições, mas, por vezes, a repetição aumenta e é aí que começa a causar problemas.

Repetições CAG

Toda a gente tem duas cópias do gene da doença de Huntington, quer estejam, quer não estejam em risco de ter a doença. Cada cópia foi herdada de um dos progenitores. E todos os genes da doença de Huntington contêm uma repetição CAG nesse gene.

O que provoca o desenvolvimento da doença é o número de vezes que o CAG é repetido. De forma simples, as pessoas que desenvolvem a doença de Huntington têm mais repetições CAG do que aquelas que não a desenvolvem. Para tornar as coisas mais claras, iremos dividir as repetições CAG em quatro intervalos diferentes. Basta apenas uma das cópias estar expandida (ter mais repetições) para causar problemas.

26 e menos (Intervalo não afectado)

Como mencionámos anteriormente, todas as pessoas têm uma repetição CAG nos seus genes da doença de Huntington (mesmo aquelas que pertencem a famílias não afectadas pela doença). A maioria das pessoas que não tem doença de Huntington tem entre cerca de 10-20 repetições CAG. De facto, todos os valores até 26 repetições CAG estão bem e não causarão nenhuns problemas. Mas, estando acima disso, podem existir complicações.

40 Repetições ou mais (Intervalo de doença)

Todos os que tiverem 40 repetições CAG ou acima disso, infelizmente, irão certamente desenvolver a doença de Huntington durante a sua vida, tendo também 50% de risco de passarem o gene a cada um dos seus filhos. A maioria das pessoas com doença de Huntington tem entre 40 a 50 repetições CAG.

As repetições no intervalo do meio, entre 27 e 39, são bastante raras. São um pouco menos claras e, de facto, os cientistas não as compreendem completamente, pelo que as designam de “zona cinzenta”.

27-35 repetições CAG (risco para as gerações futuras)

As boas notícias acerca das repetições entre 27 e 35 são a de que a pessoa que as tem não irá, ela própria, desenvolver a doença de Huntington. Contudo, há uma pequena probabilidade (cerca de 5%) de que os filhos dessa pessoa estejam em risco de ter DH. Isto deve-se ao facto de as repetições neste intervalo poderem aumentar quando são transmitidas aos filhos, podendo aumentar o seu número para um intervalo que faça com que o filho possa desenvolver a doença.

36-39 repetições CAG (penetrância reduzida)

As pessoas com repetições neste intervalo podem ou não desenvolver doença de Huntington. As pessoas neste intervalo poderão desenvolver sintomas de DH numa idade mais avançada. Por vezes, é numa idade tão tardia que podem morrer de velhice antes de quaisquer sintomas aparecerem. Contudo, o risco de passarem esta doença aos seus filhos, neste intervalo, é igualmente de 50%. Os cientistas chamam a esta imprevisibilidade “penetrância reduzida”.

Facto: As repetições CAG são aquilo que os técnicos de laboratório contam quando as pessoas fazem o TESTE GENÉTICO para a doença de Huntington.

Herdar o gene “expandido” da doença de Huntington

A questão de fundo: se o gene Huntington tem demasiadas repetições CAG provoca a doença de Huntington. Agora, iremos olhar para o modo como as pessoas herdam esse gene expandido e como a doença de Huntington pode ser transmitida nas famílias.

O risco de 50%

50% risk

As pessoas têm doença de Huntington porque herdaram o gene expandido de um progenitor. Como herdamos uma cópia de cada cromossoma de cada progenitor, temos duas cópias de cada gene – uma vinda da mãe, e outra do pai.

Assim, uma pessoa com doença de Huntington tem duas cópias do gene Huntington, uma das quais está expandida (com muitas repetições CAG) e outra que está normal.

Uma pessoa sem doença de Huntington tem também duas cópias do gene da doença, mas ambas são normais.

Portanto, um filho que tenha um progenitor com doença de Huntington tem um gene normal do progenitor não afectado, mas pode ter herdado ou o gene expandido ou o gene normal do progenitor que tem doença de Huntington.

Isso faz com que o risco de ter herdado o gene expandido seja de 50%.

Tecnicamente, há quatro resultados possíveis em relação à transmissão dos genes (como mostra a ilustração). Dois desses resultados levam a que o filho tenha o gene expandido e os outros dois a que não tenha – portanto a probabilidade é de 50%. Mas para tornar as coisas mais fáceis de compreender, podes excluir o progenitor que não tem doença de Huntington, e pensares apenas se o filho herdará o gene expandido ou o gene normal do progenitor com doença de Huntington. Em ambas as situações, é igualmente um risco de 50%.

O facto de uma pessoa herdar o gene expandido ou o gene normal resume-se a uma questão de sorte, e é por isso que podes ouvir as pessoas compararem o risco de ter doença de Huntington com o de lançar uma moeda ao ar. Cada indivíduo tem os seus próprios 50% de risco, portanto é como se toda a gente tivesse a sua própria moeda para lançar ao ar em relação à sua situação de risco.

A probabilidade de 25%

25% grandchild risk

No entanto, para alguns, o risco não é assim tão simples como 50%. Por exemplo, se o avô de uma criança tem doença de Huntington, mas o progenitor em situação de risco ainda não tiver feito o teste, então a criança tem uma probabilidade de 25% de ter herdado o gene.

Isto porque não sabemos se o progenitor tem o gene expandido ou não. Se o progenitor tiver o gene expandido, então o risco da criança passará para 50%.

Se o progenitor não tiver o gene expandido, então o risco cai de 25% para 0% - o que significa que não existe qualquer risco para a criança. Tudo depende de quais são os genes que o progenitor herdou. Até o sabermos, a criança tem um risco de 25%.

Autossómico dominante

Se uma pessoa tem um gene expandido e um gene normal, porque é que é o gene expandido que assume o controlo e causa a doença de Huntington? Porque é que o gene normal não o combate? Bem, tudo se explica com o termo “autossómico dominante”. Infelizmente, a doença de Huntington é conhecida como uma “doença autossómica dominante”, o que significa que, apesar de só uma das cópias do dois genes estar expandida, é suficiente para provocar a doença. Por outras palavras, tem o domínio sobre o gene normal. É por isso que basta apenas um gene expandido, em vez de dois, para causar a doença.

De um modo geral, esta secção explicou que o gene que causa a doença de Huntington está expandido porque tem dentro demasiadas “repetições CAG”, e que estas repetições CAG estão divididas em quatro intervalos. Analisámos o risco de herdar a doença de Huntington e como é que isso funciona. E, apesar de alguns termos complicados, como “autossómico dominante”, esperamos ter conseguido dar mais explicações do que criar confusões. Se tiveres ficado com algumas questões, sente-te à vontade para usar a secção FAZ UMA PERGUNTA, onde especialistas te darão respostas excelentes, ou podes ainda CONTACTAR A HDYO directamente para colocar as questões de forma confidencial.